Tmem192-3ha
WebSee all TMEM192 primary antibodies Description Rabbit monoclonal [EPR14330-67] to TMEM192 Host species Rabbit Tested applications Suitable for: WB, Flow Cyt (Intra) more details Species reactivity Reacts … WebTMEM192 (Transmembrane Protein 192), located on 4q32.3, is a Protein Coding gene. The gene produces a 30922 Da protein composed of 271 amino acids. TMEM192 exhibits four transmembrane segments with cytosolic N- and C-termini and forms homodimers. TMEM192 plays an important role in lysosomal function and is important for tumor cell …
Tmem192-3ha
Did you know?
WebTMEM192 is a transmembrane protein (8) that we find retains its lysosomal localization upon overexpression better than other such proteins, like lysosomal-associated membrane protein 1 (LAMP1). WebJun 20, 2012 · The results suggest that TMEM192 is important for tumor cell growth and proliferation. TMEM192 deficiency can induce autophagy in tumor cells, and can further …
WebApr 12, 2024 · H4 cells expressing lysosome-tag (TMEM192-3HA) were treated with 1 nM hGCase-hBS for 24 h, followed by cell lysis and lysosome isolation using anti-HA coated magnetic beads. WebTransmembrane protein 192 (TMEM192) has been previously identified in proteomic analyses of lysosomal membranes. TMEM192 does not exhibit any significant homology …
WebAug 13, 2024 · f INS-1E cells were co-transfected with LATS2-Myc and Tmem192-3xHA or Tmem192-2xFlag plasmids for 48 h. One set of cells were treated with 50 µM CQ for last 4 h. One set of cells were treated ... WebMar 21, 2024 · GeneCards Summary for TMEM219 Gene. TMEM219 (Transmembrane Protein 219) is a Protein Coding gene. Diseases associated with TMEM219 include …
TMEM192 Promoter ubc Tag / Fusion Protein HA (C terminal on insert) Cloning Information Cloning method Restriction Enzyme 5′ cloning site AgeI (not destroyed) 3′ cloning site EcorI (not destroyed) 5′ sequencing primer CGAAGGAATAGAAGAAGAAGGTGGAGA (Common Sequencing Primers) Resource Information Articles Citing this Plasmid 8 References
WebRAFI Component Division supplies over 5,500 standard switch combinations of Industrial Controls, Estop Safety Systems, Pushbutton, Tactile, and Keyswitch components. RAFI … how do you underscore a letter in a passwordWebTMEM192, transmembrane protein 192 Vertebrate Orthologs 3 Mutations, Alleles, and Phenotypes less Phenotype Summary 1 phenotype from 1 allele in 1 genetic background … phonics fontWebOct 26, 2024 · Tmem192-3xHA and lysosomes were detected by immunofluorescence with antibodies to the HA epitope tag and the lysosomal marker LAMP2, respectively. Scale … how do you understandWebTransmembrane protein 192 (TMEM192) has been previously identified in proteomic analyses of lysosomal membranes.TMEM192 shows a wide expression pattern in mouse tissues. Interestingly, TMEM192 was found to be highly expressed in tumor cell lines, while it was not expressed or detected at low levels in normal cell lines (PMID: 22736246). how do you understand awful-tasting medicineWebTMEM192 Antibodies Antibodies that detect TMEM192 can be used in several scientific applications, including Immunohistochemistry, Western Blot, Immunocytochemistry, Immunoprecipitation and ELISA. These antibodies target TMEM192 in Human, Mouse and Rat samples. Our TMEM192 polyclonal and recombinant monoclonal antibodies are … phonics for 3rd gradersWebThe original EGFP was removed, and Tmem192-mRFP-3xHA was inserted at NheI and EcoRI sites into the pLJM1 backbone. Vector type Mammalian Expression, Lentiviral Selectable … phonics for 21st century kidsWebMar 21, 2024 · TMEM192 (Transmembrane Protein 192) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein homodimerization activity . Additional gene information for TMEM192 Gene HGNC (26775) NCBI Entrez Gene (202431) Ensembl (ENSG00000170088) UniProtKB/Swiss-Prot (Q8IY95) Open Targets Platform … how do you underscore an email address